ID: 1037855405_1037855416

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1037855405 1037855416
Species Human (GRCh38) Human (GRCh38)
Location 8:22367613-22367635 8:22367663-22367685
Sequence CCTGTCCGCCTGGAGGGTGCGGG AGCGTGGGTCGCCGCGCCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121} {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!