ID: 1037855407_1037855410

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1037855407 1037855410
Species Human (GRCh38) Human (GRCh38)
Location 8:22367618-22367640 8:22367633-22367655
Sequence CCGCCTGGAGGGTGCGGGATGCT GGGATGCTAGAGCCGCAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134} {0: 1, 1: 0, 2: 2, 3: 8, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!