ID: 1037862212_1037862219

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1037862212 1037862219
Species Human (GRCh38) Human (GRCh38)
Location 8:22413516-22413538 8:22413548-22413570
Sequence CCTGGAAAGTCAACATGAAAGTG TGGAGGGTGGTGATTCAATTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 31, 4: 224} {0: 1, 1: 0, 2: 0, 3: 19, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!