ID: 1037885924_1037885931

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1037885924 1037885931
Species Human (GRCh38) Human (GRCh38)
Location 8:22596323-22596345 8:22596357-22596379
Sequence CCTCTGGCTCTTGTTCTTTGGTG TCTCCTCCCAGGGGTCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 236} {0: 1, 1: 0, 2: 5, 3: 26, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!