ID: 1037892056_1037892070

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1037892056 1037892070
Species Human (GRCh38) Human (GRCh38)
Location 8:22628706-22628728 8:22628759-22628781
Sequence CCATGGGTGCCTGTGGCAGCCTC GGCACAGAAAAGCCCTCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 354} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!