ID: 1038345051_1038345065

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1038345051 1038345065
Species Human (GRCh38) Human (GRCh38)
Location 8:26725062-26725084 8:26725106-26725128
Sequence CCCACCCAAATGTCATCTTGAAT GTGTCATGGGAGGGACCTGGTGG
Strand - +
Off-target summary {0: 120, 1: 8137, 2: 11204, 3: 10271, 4: 7748} {0: 277, 1: 965, 2: 2779, 3: 5347, 4: 8057}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!