ID: 1038345057_1038345068

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1038345057 1038345068
Species Human (GRCh38) Human (GRCh38)
Location 8:26725093-26725115 8:26725117-26725139
Sequence CCACGATCCCCACGTGTCATGGG GGGACCTGGTGGGAGGTAATTGG
Strand - +
Off-target summary No data {0: 51, 1: 874, 2: 3004, 3: 5007, 4: 5168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!