ID: 1038345063_1038345073

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1038345063 1038345073
Species Human (GRCh38) Human (GRCh38)
Location 8:26725102-26725124 8:26725130-26725152
Sequence CCACGTGTCATGGGAGGGACCTG AGGTAATTGGATCATGGGGATGG
Strand - +
Off-target summary {0: 92, 1: 666, 2: 2004, 3: 4781, 4: 7410} {0: 19, 1: 479, 2: 3371, 3: 6438, 4: 7186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!