ID: 1038417453_1038417463

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1038417453 1038417463
Species Human (GRCh38) Human (GRCh38)
Location 8:27407591-27407613 8:27407629-27407651
Sequence CCTTTGGAAGAATTTAGAGCCAC CCCGGGAGGTGGGTCTCCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!