ID: 1038435743_1038435750

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1038435743 1038435750
Species Human (GRCh38) Human (GRCh38)
Location 8:27534820-27534842 8:27534862-27534884
Sequence CCCAGGAGAGCACATTCAAGGCT CAGAGTTACCCCTTGGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!