ID: 1038566466_1038566472

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1038566466 1038566472
Species Human (GRCh38) Human (GRCh38)
Location 8:28623234-28623256 8:28623262-28623284
Sequence CCTCGCGCGCTGTCAGGAGGCGC CCGTGGGTAAGCCCGTGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 63} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!