ID: 1038666557_1038666564

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1038666557 1038666564
Species Human (GRCh38) Human (GRCh38)
Location 8:29542698-29542720 8:29542742-29542764
Sequence CCCTCACTAAATTTAATAAGTGC GGCACCACAGGACCAGAAGGCGG
Strand - +
Off-target summary No data {0: 4, 1: 20, 2: 51, 3: 52, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!