ID: 1038765394_1038765405

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1038765394 1038765405
Species Human (GRCh38) Human (GRCh38)
Location 8:30423369-30423391 8:30423408-30423430
Sequence CCTCTTTCCTCTTTGTGTATGCA CTACCTCGGAGGGGACAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 354} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!