ID: 1038781099_1038781103

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1038781099 1038781103
Species Human (GRCh38) Human (GRCh38)
Location 8:30569008-30569030 8:30569024-30569046
Sequence CCGCCTGCTCAGGGGCTGGGGCA TGGGGCATTGGGAAGCTGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 155, 4: 1345} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!