ID: 1038942949_1038942951

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1038942949 1038942951
Species Human (GRCh38) Human (GRCh38)
Location 8:32325636-32325658 8:32325652-32325674
Sequence CCCAAAGTGCTGGGAATATAGGC TATAGGCATGTGCCCACACCTGG
Strand - +
Off-target summary {0: 115, 1: 21843, 2: 250376, 3: 273107, 4: 178790} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!