ID: 1038993696_1038993701

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1038993696 1038993701
Species Human (GRCh38) Human (GRCh38)
Location 8:32898124-32898146 8:32898155-32898177
Sequence CCTTAAGATTAAGTTAAAATGAG GAGTGATACCATAAGAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 296} {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!