ID: 1039289168_1039289174

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1039289168 1039289174
Species Human (GRCh38) Human (GRCh38)
Location 8:36075380-36075402 8:36075423-36075445
Sequence CCATCCGATAGCCAGACAGCCCT TGACATACATTTTACTGCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 66} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!