ID: 1039454320_1039454324

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1039454320 1039454324
Species Human (GRCh38) Human (GRCh38)
Location 8:37697383-37697405 8:37697402-37697424
Sequence CCGGCGGCGGCGACTCCCGCAAA CAAAGACAGCGGCTCCTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 33} {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!