ID: 1039469963_1039469970

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1039469963 1039469970
Species Human (GRCh38) Human (GRCh38)
Location 8:37807249-37807271 8:37807275-37807297
Sequence CCCTTGCAGTCAGGCTAAATGCA GAAGGCAGCCACGGAGGGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!