ID: 1039503948_1039503956

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1039503948 1039503956
Species Human (GRCh38) Human (GRCh38)
Location 8:38038092-38038114 8:38038141-38038163
Sequence CCCTCCTACTTATCCTCATACAG TACAATTTTTGACTTTACGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!