ID: 1039554214_1039554222

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1039554214 1039554222
Species Human (GRCh38) Human (GRCh38)
Location 8:38465562-38465584 8:38465604-38465626
Sequence CCTAACCCACTGGGGGTAGGATA AGGCAGGCCATCGGCAAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 74} {0: 1, 1: 0, 2: 2, 3: 8, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!