ID: 1039572838_1039572845

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1039572838 1039572845
Species Human (GRCh38) Human (GRCh38)
Location 8:38601086-38601108 8:38601139-38601161
Sequence CCACAGCTTCCCGAGCAGTCTCC GCCCCGCCCCGCTCGCGATTTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 5, 3: 38, 4: 412} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!