ID: 1039572841_1039572853

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1039572841 1039572853
Species Human (GRCh38) Human (GRCh38)
Location 8:38601107-38601129 8:38601148-38601170
Sequence CCAAACATATATTACATTCGAAG CGCTCGCGATTTGGCCCCTCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 1, 4: 12}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!