ID: 1039588667_1039588669

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1039588667 1039588669
Species Human (GRCh38) Human (GRCh38)
Location 8:38728637-38728659 8:38728650-38728672
Sequence CCTGGGGACCGACTCTGGGGACC TCTGGGGACCCTCGCCGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 133} {0: 1, 1: 0, 2: 1, 3: 3, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!