ID: 1039763681_1039763685

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1039763681 1039763685
Species Human (GRCh38) Human (GRCh38)
Location 8:40606038-40606060 8:40606077-40606099
Sequence CCCTTTACCTTCAGTTTATGTGA GATTAGTCTCTTGAAGACAGTGG
Strand - +
Off-target summary {0: 5, 1: 338, 2: 491, 3: 463, 4: 993} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!