ID: 1039763682_1039763685

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1039763682 1039763685
Species Human (GRCh38) Human (GRCh38)
Location 8:40606039-40606061 8:40606077-40606099
Sequence CCTTTACCTTCAGTTTATGTGAG GATTAGTCTCTTGAAGACAGTGG
Strand - +
Off-target summary {0: 4, 1: 327, 2: 470, 3: 415, 4: 820} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!