ID: 1039859825_1039859831

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1039859825 1039859831
Species Human (GRCh38) Human (GRCh38)
Location 8:41447539-41447561 8:41447554-41447576
Sequence CCAGTGGGTCATCCCAGTTCAGG AGTTCAGGTAGAGCTGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!