ID: 1039930444_1039930449

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1039930444 1039930449
Species Human (GRCh38) Human (GRCh38)
Location 8:41982637-41982659 8:41982664-41982686
Sequence CCCATTTGTTAGTCACTTAGTGG CTGGGTTATCAGACTGTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 3, 3: 42, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!