ID: 1040054322_1040054326

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1040054322 1040054326
Species Human (GRCh38) Human (GRCh38)
Location 8:43044256-43044278 8:43044299-43044321
Sequence CCCAAGAGGGAGAGGCGGCAGTG ACTCCAGCCTGAGCGACAGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 204, 3: 5858, 4: 58721} {0: 60, 1: 2127, 2: 7242, 3: 6867, 4: 6059}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!