ID: 1040443956_1040443967

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1040443956 1040443967
Species Human (GRCh38) Human (GRCh38)
Location 8:47474458-47474480 8:47474505-47474527
Sequence CCCCAGTCACAACATCTCACTCC CTCTTTCTGGTGGGAGTGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 279} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!