ID: 1040454755_1040454756

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1040454755 1040454756
Species Human (GRCh38) Human (GRCh38)
Location 8:47585690-47585712 8:47585706-47585728
Sequence CCTTCTTGCTGGTGGAGACTCTG GACTCTGCAGAGTCTTGAGATGG
Strand - +
Off-target summary {0: 8, 1: 74, 2: 182, 3: 317, 4: 509} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!