ID: 1040491318_1040491330

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1040491318 1040491330
Species Human (GRCh38) Human (GRCh38)
Location 8:47924966-47924988 8:47925006-47925028
Sequence CCTCCATCGCCCTTCTCACCCTG CAGACAGCTGTCCCAACACGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 397} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!