ID: 1040491319_1040491330

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1040491319 1040491330
Species Human (GRCh38) Human (GRCh38)
Location 8:47924969-47924991 8:47925006-47925028
Sequence CCATCGCCCTTCTCACCCTGCCT CAGACAGCTGTCCCAACACGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 56, 4: 682} {0: 1, 1: 1, 2: 0, 3: 7, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!