ID: 1040604651_1040604656

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1040604651 1040604656
Species Human (GRCh38) Human (GRCh38)
Location 8:48919944-48919966 8:48919980-48920002
Sequence CCTTGCCGCAGATCTTGCAAACA GGGTCCGAATATGCATCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85} {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!