ID: 1040717564_1040717568

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1040717564 1040717568
Species Human (GRCh38) Human (GRCh38)
Location 8:50275860-50275882 8:50275906-50275928
Sequence CCATTCTTACTTGGATCTAAGAA CTGGTTTCTCTTGAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 183} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!