ID: 1040761357_1040761363

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1040761357 1040761363
Species Human (GRCh38) Human (GRCh38)
Location 8:50849327-50849349 8:50849380-50849402
Sequence CCCGGCACTACTGCTCCTCAGTC TAAGCTGCCCTGGCTTAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!