ID: 1041031329_1041031331

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1041031329 1041031331
Species Human (GRCh38) Human (GRCh38)
Location 8:53738388-53738410 8:53738441-53738463
Sequence CCACAGAAGGAAGAGAAAGCAAT CTACCTCTCCTTACTAGACCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 53, 4: 520} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!