ID: 1041159660_1041159662

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1041159660 1041159662
Species Human (GRCh38) Human (GRCh38)
Location 8:55026578-55026600 8:55026593-55026615
Sequence CCTACAGGGTGTTCTTAAGCAGG TAAGCAGGCAACTCCACCATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!