ID: 1041201354_1041201364

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1041201354 1041201364
Species Human (GRCh38) Human (GRCh38)
Location 8:55453846-55453868 8:55453889-55453911
Sequence CCAGCTCATCAAACAGGTCCGTG CTCCAACACAAAGAGAGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 59} {0: 1, 1: 0, 2: 0, 3: 43, 4: 880}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!