ID: 1041224733_1041224737

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1041224733 1041224737
Species Human (GRCh38) Human (GRCh38)
Location 8:55687093-55687115 8:55687115-55687137
Sequence CCTTATCTCTATTTCCCTGAAAT TCTCTCTGCCTGGCCTCCTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!