ID: 1041253404_1041253405

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1041253404 1041253405
Species Human (GRCh38) Human (GRCh38)
Location 8:55956926-55956948 8:55956969-55956991
Sequence CCTGCTCTAAGTGTGTTTGCATT GCTGTAGCACTGTGAATGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 188} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!