ID: 1041355203_1041355209

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1041355203 1041355209
Species Human (GRCh38) Human (GRCh38)
Location 8:56993194-56993216 8:56993226-56993248
Sequence CCCACCTGGACGCTGGGGAAGGC CAGGTAGAACATCTTGCGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 219} {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!