ID: 1041425316_1041425322

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1041425316 1041425322
Species Human (GRCh38) Human (GRCh38)
Location 8:57714151-57714173 8:57714164-57714186
Sequence CCTTTCCCCATCAATAAATGGTG ATAAATGGTGCTGGGAAAACTGG
Strand - +
Off-target summary No data {0: 12995, 1: 9164, 2: 7523, 3: 6813, 4: 5740}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!