ID: 1041425316_1041425324

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1041425316 1041425324
Species Human (GRCh38) Human (GRCh38)
Location 8:57714151-57714173 8:57714192-57714214
Sequence CCTTTCCCCATCAATAAATGGTG CACATGTAGAAAGCTGAAACTGG
Strand - +
Off-target summary No data {0: 210, 1: 11343, 2: 4549, 3: 4260, 4: 4677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!