ID: 1041650988_1041650991

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1041650988 1041650991
Species Human (GRCh38) Human (GRCh38)
Location 8:60302691-60302713 8:60302721-60302743
Sequence CCTTTGTTAAGGAATTGGTTAAT GAAAACCTTGATACTCACAGGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 38, 3: 41, 4: 251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!