ID: 1041761202_1041761210

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1041761202 1041761210
Species Human (GRCh38) Human (GRCh38)
Location 8:61368464-61368486 8:61368509-61368531
Sequence CCTTGTTCTTGGACAAGAACATT TAGCATTGGTCAGATAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 508} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!