ID: 1041777225_1041777226

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1041777225 1041777226
Species Human (GRCh38) Human (GRCh38)
Location 8:61536679-61536701 8:61536711-61536733
Sequence CCTGGCTATTTGGGGCTATTCTG GAATTGATTGTGTAGCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 95} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!