ID: 1041803447_1041803450

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1041803447 1041803450
Species Human (GRCh38) Human (GRCh38)
Location 8:61824370-61824392 8:61824409-61824431
Sequence CCCAAGATTGGGTAATTTATCAA TACTCACAGTTCCCCAGGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 42, 3: 659, 4: 5314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!