ID: 1041823797_1041823803

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1041823797 1041823803
Species Human (GRCh38) Human (GRCh38)
Location 8:62068616-62068638 8:62068640-62068662
Sequence CCCATGACAGCTGCCGGGAGTGG GCTGTACCCTGCAAAGTCACAGG
Strand - +
Off-target summary No data {0: 57, 1: 963, 2: 1540, 3: 1484, 4: 1213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!