ID: 1041823802_1041823810

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1041823802 1041823810
Species Human (GRCh38) Human (GRCh38)
Location 8:62068629-62068651 8:62068664-62068686
Sequence CCGGGAGTGGGGCTGTACCCTGC GCAGAGCTACCCAAGGCCATGGG
Strand - +
Off-target summary {0: 29, 1: 117, 2: 610, 3: 878, 4: 896} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!